A Study of the Virulence of Campylobacter coli Essay
A Study of the Virulence of Campylobacter coli Essay
his study aims to explore the foodborne pathogen C. coli as limited studies are conducted in this topic and to characterize a number of C. coli isolates from organic chicken in terms of their virulence potential using a range of techniques including association and invasion assays and some PCR screening for known virulence genes. Also, the study intends to stimulate people to eat organic chicken instead of frozen ones that are most likely to be infected with bacterial pathogens such as C. coli.
The significance of Campylobacter coli in spreading microbial intestinal infections gains worldwide recognition as its properties and virulence are slowly being exposed. Luber, et al. 92003) considered Campylobacter spp.A Study of the Virulence of Campylobacter coli Essay. as one of the major causes of infectious intestinal illnesses such as bacterial diarrhea and gastroenteritis in humans all over the world. A total of 2.4 million reported illnesses and 150 mortalities are caused by the genus Campylobacter every year in the United States (Mead, et al., 1999). Infections, particularly from Campylobacter jejuni and C. coli, amounts to 420,000 cases of intestinal disease in England alone every year (Tam et al., 2003), while it ranks second in the leading causes of bacterial food poisoning in the United States (Miller, et al., 2006). In addition, the English case-control Infectious Intestinal Disease Study revealed that among the cases from 1993 to 1996, Campylobacter spp. amounts to a percentage of 23% among all detected enteric pathogens from fecal samples (Amar, et al., 2007).
There are 11 species of Campylobacter that are pathogenic to humans and animals, with C. jejuni and C. coli as the most frequently isolated species in food products (He, et al., 2010). Gurtler, et al. (2005) emphasized the importance of C. coli in human campylobacter contagions as their research uncovered that it comprises about 18.6% of Campylobacter spp. found in an infected human body. According to the World Health Organization (2011), infections caused by Campylobacter spp. is mild but fatal especially to infants and elderly people. It is generally regarded as the foremost cause of gastroenteritis, diarrhea, and other intestinal diseases in developing and developed countries. The strong impact and high prevalence of Campylobacter foodborne illnesses placed the said bacteria to the list of pathogens of high significance in terms of health and socio-economic viewpoint. A Study of the Virulence of Campylobacter coli Essay.
ORDER A PLAGIARISM-FREE PAPER NOW
The presence of virulence factors (VFs) and mechanisms of quinolones and macrolide resistance was analyzed in Campylobacter spp. from a pediatric cohort study in Lima. In 149 isolates (39 Campylobacter jejuni and 24 Campylobacter coli from diarrheic cases; 57 C. jejuni and 29 C. coli from controls), the presence of the cdtABC and cadF genes and iam marker was established. Nalidixic acid, ciprofloxacin, erythromycin, and azithromycin susceptibilities were established in 115 isolates and tetracycline-susceptibility was established in 100 isolates. The presence of mutations in the gyrA,parC, and 23S rRNA genes was determined. The cadF gene and all genes from thecdtABC operon were significantly more frequent among C. jejuni (P < 0.0001); the iam marker was more frequent in C. coli (P < 0.0001). No differences were observed in VFs between cases and controls. Almost all isolates were tetracycline-resistant; nalidixic acid and ciprofloxacin resistance reached levels of 90.4% and 88.7%, respectively. Resistance to macrolides was 13% (C. jejuni 4.3%; C. coli 26.1%). Resistance to ciprofloxacin was related to GyrA Thr86 substitutions, while 13 of 15 macrolide-resistant isolates possessed a 23S rRNA mutation (A2075G). Differences in the presence of VFs and alarming levels of resistance to tested antimicrobial agents were observed among C. jejuni and C. coli.
1. Introduction
Campylobacter spp. ranks among the most relevant causes of diarrheal illness worldwide, with recent estimations of around 166,000 cases/year, including 31,700 Guillain-Barré Syndromes, which lead to 37,604 deaths and 3,733,822 Disability Adjusted Life Years (DALYs) [1].A Study of the Virulence of Campylobacter coli Essay. In addition, other severe sequelae, such as Miller-Fisher syndrome (a subtype of Guillain-Barré Syndrome), have been described [2, 3]. Although other Campylobacter species have clinical relevance, Campylobacter jejuni and Campylobacter coli have classically been considered the most relevant human pathogens belonging to this genus [2].
Although relatively little is known about the virulence of Campylobacter spp., these microorganisms possess different virulence factors (VFs) related to motility, adhesion, invasion, toxin-activity, immune evasion, and iron-uptake, among others [2]. Thus, while factors, like the cadF gene or the iam locus, are involved in different invasion steps [4, 5] others such as the cytolethal distending toxin, a tripartite toxin encoded in the cdtA, cdtB, and cdtC genes which is also present in other microorganisms [6], block the CDC2 kinase, leading to progressive cellular distension which results in cell death [2].
Diarrhea by Campylobacter spp. is usually a self-limited disease which only requires oral rehydration. However, in some cases (immunocompromised patients, long duration of symptoms, and patients with severe complications) the use of antimicrobial agents may be required [7]. Currently, macrolides are the drugs of choice, with fluoroquinolones as second-line drugs quinolones [7]. However, the presence of quinolone-resistant Campylobacter spp. isolates is not a novel event [8–10]. Moreover, the development of quinolone resistance during antibiotic treatment has also been reported [7, 11]. In general, the amino acid substitutions in the A subunits (GyrA and ParC) of the DNA-Gyrase and Topoisomerase IV are the most relevant mechanisms of quinolone resistance [12]. In addition, alterations in cytoplasmic quinolone uptake and a series of transferable mechanisms of quinolone resistance (TMQR) also play a role in the increasing levels of quinolone resistance [12, 13]. Interestingly, Campylobacter spp. does not possess a Topoisomerase IV, and thus a single amino acid substitution at GyrA may result in high levels of quinolone resistance [12]. The most frequently described amino acid substitution in Campylobacter spp. affects positions 86 and 90 of GyrA, with the amino acid change Thr86-Ile being the most widely described [8, 14]. In addition, the relevant role of CmeABC, a resistance-nodulation-cell division (RND) efflux pump, has also been described [15]. Finally, to the best of our knowledge, up to now TMQR has not been described in Campylobacter spp. A Study of the Virulence of Campylobacter coli Essay.
Regarding macrolides, the isolation of resistant Campylobacter spp. is increasingly reported [16, 17], being especially of note in isolates of an animal origin [10, 18]. In both animal and human isolates, macrolide resistance is more frequent in C. coli [9, 10, 16, 18]. Macrolides interact with the 50S subunit of the ribosome, inhibiting protein elongation and thus protein synthesis [19]. Alterations at the interaction points of the 23S rRNA, L4, or L22 proteins result in the development of macrolide resistance in a wide range of microorganisms [19]. However, the clinical relevance of mutations in the23S rRNA gene is closely related to the copy number of the gene that each microorganism possesses [19]. Thus, in Campylobacter spp., which has 3 copies of the23S rRNA gene, mutations in more than one gene copy results in the development of macrolide resistance [20]. Mutations such as A2074G/T, A2075G, and A2076G (equivalent to A2057G/T, A2058G, and A2059G following E. coli numeration) have been described in Campylobacter spp., with those affecting A2075 being the most frequently detected [14, 16, 20]. Although L4 and L22 amino acid substitutions, such as the amino acid changes Gly74-Asp in L4 or Ala86-Glu in L22 or the insertions 86::Ala-Arg-Ala-Arg::87 or 98::Thr-Ser-His::99 in L22, have been related to the acquisition of macrolide resistance in Campylobacter spp. [14, 21], the role of alterations at L4 and L22 seems to be of less relevance in Campylobacter clinical isolates [16, 20]. In fact, it has been described that these alterations may lead to a negative effect on bacterial fitness levels [19]. Additionally, extrusion of macrolides from the bacterial cytoplasm by CmeABC has also been reported [21]. To the best of our knowledge, the erm(B) gene, which may be encoded within a transferable multidrug-resistant genomic island, is currently the only transferable mechanism of macrolide resistance (TMMR) described inCampylobacter spp. [22].
The aim of this study was to determine the presence of several VFs and the levels and molecular mechanisms of resistance to quinolones and macrolides in a series ofCampylobacter spp. isolates recovered from children less than 18 months of age, in a periurban area of Lima, Peru. A Study of the Virulence of Campylobacter coli Essay.
2. Material and Methods
2.1. Microorganisms
One hundred forty-nine Campylobacter spp. (Supplemental material, available online at https://doi.org/10.1155/2017/7848926) recovered from feces of children less than 18 months old with (63 isolates) and without (86 isolates) diarrhea, during a double-blind controlled trial of bovine lactoferrin for the prevention of diarrhea in children in Lima between January 2008 and May 2011, were included in the study [25]. After initial culture at 42°C in chocolate agar and microaerophilic conditions, followed byCampylobacter phenotypic identification (evaluation of colony morphology, Gram staining, and oxidase and catalase determinations), DNA was extracted by direct boiling of 1 colony of each isolate and both DNA and microorganisms were frozen until analysis. A C. coli clinical isolate kindly provided by the Instituto Nacional de Salud from Lima (Peru) and C. jejuni ATCC 33560, Escherichia coli ATCC 25922, andStaphylococcus aureus ATCC 25923 were used as control.
2.2. Species Determination
C. coli and C. jejuni were identified by PCR using the primers and conditions previously described (Table 1). The amplified products were analyzed in a 1.5% electrophoresis gel and stained with SYBR Safe (Invitrogen, Eugene, USA). Amplified products were selected at random and sequenced (Macrogen, Seoul, Korea) as quality control.
Table 1
Primers and PCR conditions used in the present study.
| Target | Description | Primer (5′-3′) | Size (bp) | Ann | Cycles | Ref |
|---|---|---|---|---|---|---|
| Identification | ||||||
|
|
||||||
| C. coli∗ | AGGCAAGGGAGCCTTTAATC | 364 | 61 | 30 | [23] | |
| TATCCCTAT CTACAAATTCGC | ||||||
| C. jejuni ∗ | CATCTTCCCTAGTCAAGCCT | 773 | 61 | 30 | [23] | |
| AAG ATATGGCACTAGCAAGAC | ||||||
|
|
||||||
| Resistance | ||||||
|
|
||||||
| gyrA | DNA-Gyrase subunit A | ATGATGAGGCAAAAAGAGA | 410 | 55 | 30 | [8] |
| TAAACTATGAGGTGGGATGT | ||||||
| 23S rRNA | GTAAACGGCGGCCGTAACTA | 699 | 52 | 35 | [24] | |
| GACCGAACTGTCTCACGACG | ||||||
|
|
||||||
| Virulence | ||||||
|
|
||||||
| cadF | Campylobacteradhesin to fibronectin | TTGAAGGTAATTTAGATATG | 400 | 45 | 30 | [23] |
| CTAATACCTAAAGTTGAAAC | ||||||
| cdtABC | Cytolethal distending Toxin subunits ABC | GGAAATTGGATTTGGGGCTATACT | 1215 | 55 | 30 | [23] |
| TTGCACATAACCAAAAGGAAG | ||||||
| cdtA | Cytolethal distending Toxin subunit A | CCTTGTGATGCAAGCAATC | 370 | 42 | 30 | [23] |
| ACACTCCATTTGCTTTCTG | ||||||
| cdtB | Cytolethal distending Toxin subunit B | GTTAAAATCCCCTGCTATCAACCA | 495 | 42 | 30 | [23] |
| GTTGGCACTTGGAATTTGCAAGGC | ||||||
| cdtC | Cytolethal distending Toxin subunit C | CGATGAGTTAAAACAAAAAGATA | 182 | 42 | 30 | [23] |
| TTGGCATTATAGAAAATACAGTT | ||||||
| iam1 | Invasión-associated marker 1 | GCGCAAAATATTATCACCC | 518 | 52 | 30 | [23] |
| TTCACGACTACTATGCGG | ||||||
| iam2 | Invasion-associated marker 2 | GGCGCTTTAGGGAAGCTG | 1360 | 52 | 30 | [23] |
| CTTTAAATTGAATCACGGG | ||||||
| iam3 | Invasion-associated marker 3 | TGAGGAGCTAAGGGTGCAAA | 270 | 52 | 30 | [23] |
| AATACTGATATTTTCCACAT | ||||||
bp: base pair; Ann: annealing; Ref: reference. ∗Primers used in a Multiplex PCR.
2.3. Virulence Factors
The presence of the cadF, cdtA, cdtB, and cdtC genes plus that of the full cdt cluster and the iam marker was determined by PCR [23] (Table 1). A Study of the Virulence of Campylobacter coli Essay.
2.4. Antimicrobial Susceptibility
The antimicrobial susceptibility to azithromycin (Azm, 15 μg), erythromycin (Ery, 15 μg), nalidixic acid (Nal, 30 μg), ciprofloxacin (Cip, 5 μg), and tetracycline (Tc, 30 μg) was established by disk diffusion following the EUCAST guidelines in the microorganisms recovered from frozen stock. The EUCAST (Ery, Cip, and Tc) (http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_6.0_Breakpoint_table.pdf) and BSAC (Nal) (http://bsac.org.uk/wp-content/uploads/2012/02/Table-20.pdf) guidelines were used to interpret the obtained diameter. In the absence of established breakpoints, Azm was interpreted according to the following scheme: susceptible ≥ 18 mm and resistant ≤ 17 mm.
2.5. Analysis of Mutations in the gyrA and 23S rRNA Genes
In strains with susceptibility data, the presence of mutations in the gyrA and 23S rRNA genes was determined by PCR using the primers and conditions previously described (Table 1). In the case of the gyrA gene, the DNAs initially obtained for the nongrowing isolates were also included in the study. The amplified products were recovered and purified (PCR Clean-Up System (Promega, Madison, WI)) following the manufacturer’s instructions. Both strands of purified products were sequenced (Macrogen, Seoul, Korea).
2.6. Statistical Analysis
Fisher’s exact test was used to analyze the data.
3. Results
3.1. Identification
Of the total strains analyzed, 96 (64.4%) were C. jejuni and 53 (35.6%) C. coli; of these, 39 C. jejuni and 24 C. coli were from diarrheic cases, while 57 C. jejuni and 29 C. coliwere from healthy controls (Table 2). No differences were found in relation to sex in the prevalence of C. jejuni and C. coli. A Study of the Virulence of Campylobacter coli Essay.
Table 2
Samples type.
| n (%) | |||
|---|---|---|---|
| Diarrhea (n = 63) |
Asymptomatic control (n = 86) |
Total (n = 149) |
|
| C. jejuni | 39 (61.9) | 57 (66.3) | 96 (64.4) |
| C. coli | 24 (38.1) | 29 (33.7) | 53 (35.6) |
| Total | 63 (100) | 76 (100) | 149 (100) |
3.2. Virulence Factor Analysis
The cadF gene was present in all the isolates except 2 C. jejuni isolates from the control group. The complete cdtABC operon was amplified in 87 (58.4%) isolates (85 C. jejuniand 2 C. coli) being significantly more frequent among C. jejuni (88.7% versus 3.7%) (P< 0.001). Regarding the cdt genes, cdtB was present in 121 isolates (81.2%), while cdtAand cdtC were present in 102 (67.1%) and 103 (68.7%) isolates, respectively. Independently, all 3 genes were significantly more present in C. jejuni than in C. coli (P< 0.0001) (Table 3). In 1 C. jejuni full cdtABC amplification was achieved; howevercdtA, cdtB, or cdtC genes could not be amplified. Similarly 11 C. jejuni and 4 C. coliamplify all genes in independent manner, but no PCR product was obtained when the primers for cdtABC were used. Regarding the iam marker the 3 sequences sought were more frequently detected in C. coli than in C. jejuni (93.1%, 89.7%, and 96.6% versus 4.0%, 4.0%, and 5.1% for iam1, iam2, and iam3, resp.) (P < 0.0001). All 3 sequences were detected concomitantly in the 89.7% of C. coli and 4.0% of C. jejuni (P = 0.0001) (Table 3). No differences in the prevalence of sought VFs were found among isolates from cases and control or sex groups.
Table 3
Campylobacter virulence factors.
| VF | C. jejuni | C. coli | P | All Campylobacter | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| D (39) | C (57) | T (97) | D (24) | C (29) | T (53) | D (63) | C (86) | T (149) | |||||||||||
| N | % | N | % | N | % | N | % | N | % | N | % | N | % | N | % | N | % | ||
| cadF | 39 | 100.0 | 55 | 96.4 | 95 | 97.9 | 24 | 100.0 | 29 | 100.0 | 53 | 100.0 | 63 | 100 | 84 | 97.7 | 147 | 98.7 | |
| cdtABC† | 35 | 89.7 | 50 | 87.7 | 86 | 88.7∗ | 2 | 8.3 | 0 | 0.0 | 2 | 3.8∗ | <0.0001 | 37 | 58.7 | 50 | 59.5 | 87 | 58.4 |
| cdtA | 39 | 100.0 | 56 | 98.2 | 96 | 99.0∗ | 3 | 12.5 | 4 | 13.8 | 7 | 13.2∗ | <0.0001 | 42 | 66.7 | 60 | 71.4 | 102 | 68.5 |
| cdtB | 39 | 100.0 | 56 | 98.2 | 96 | 99.0∗ | 11 | 45.8 | 15 | 51.7 | 26 | 49.1∗ | <0.0001 | 50 | 79.4 | 71 | 84.5 | 121 | 81.2 |
| cdtC | 39 | 100.0 | 56 | 98.2 | 96 | 99.0∗ | 3 | 12.5 | 5 | 17.2 | 8 | 15.1∗ | <0.0001 | 42 | 66.7 | 61 | 72.6 | 103 | 69.1 |
| iam | 3 | 7.7 | 1 | 1.7 | 4 | 4.0∗ | 21 | 87.5 | 26 | 89.7 | 47 | 88.7∗ | <0.0001 | 24 | 38.1 | 27 | 32.1 | 51 | 34.2 |
| iam1 | 3 | 7.7 | 1 | 1.7 | 4 | 4.0∗ | 23 | 95.8 | 27 | 93.1 | 50 | 94.3∗ | <0.0001 | 26 | 41.3 | 28 | 33.3 | 54 | 36.2 |
| iam2 | 3 | 7.7 | 1 | 1.7 | 4 | 4.0∗ | 21 | 87.5 | 26 | 89.7 | 47 | 88.7∗ | <0.0001 | 24 | 38.1 | 27 | 32.1 | 51 | 34.2 |
| iam3 | 4 | 10.3 | 1 | 1.7 | 5 | 5.1∗ | 23 | 95.8 | 28 | 96.6 | 51 | 96.2∗ | <0.0001 | 27 | 27.0 | 29 | 34.5 | 56 | 37.6 |
D: diarrhea; C: control; T: total; VF: virulence factor; N: number; %: percentage. ∗The presence of significant differences between specific groups. †In 1 C. jejuni the cdtABC operon was amplified but no individual gene amplification was obtained; similarly in 11 C. jejuni and 4 C. coli cases the 3 individual genes were amplified, but no amplification for the full cdtABCoperon was obtained.
3.3. Antimicrobial Resistance Levels
The resistance levels to quinolones and macrolides were determined in 115 isolates (69C. jejuni, 46 C. coli) able to grow from frozen stock, while the resistance levels to Tc were also established in 100 out of these isolates.
Regarding quinolones, the results showed almost full concordance (only 2 NalR C. jejuniisolates from the diarrhea group were not resistant to Cip) and also extremely high levels of resistance (104 isolates, 90.4% to Nal; 102 isolates, 88.7% to Cip). Likewise, extremely high levels of resistance to Tc were observed (96 isolates, 96.0%). A Study of the Virulence of Campylobacter coli Essay. Meanwhile, only 15 (13.0%) isolates showed resistance to both Ery and Azm. All macrolide-resistant microorganisms also showed resistance to the quinolones tested (Table 4).
Table 4
Campylobacter antimicrobial resistance levels.
| Ab | Antibiotic resistance | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C. jejuni | C. coli | All Campylobacter | ||||||||||||||||
| Diarrhea | Control | Total | Diarrhea | Control | Total | Diarrhea | Control | Total | ||||||||||
| n/N | % | n/N | % | n/N | % | n/N | % | n/N | % | n/N | % | n/N | % | n/N | % | n/N | % | |
| Nal | 28/30 | 93.3 | 34/39 | 87.2 | 62/69 | 89.8 | 20/21 | 95.2 | 22/25 | 88.0 | 42/46 | 91.3 | 48/51 | 94.1 | 56/64 | 87.5 | 104/115 | 90.4 |
| Cip | 26/30 | 86.7 | 34/39 | 87.2 | 60/69 | 87.0 | 20/21 | 95.2 | 22/25 | 88.0 | 42/46 | 91.3 | 46/51 | 90.2 | 56/64 | 87.5 | 102/115 | 88.7 |
| Ery | 2/30 | 6.7 | 1/39 | 2.6∗ | 3/69 | 4.3‡ | 6/21 | 28.6 | 6/25 | 24.0∗ | 12/46 | 26.1‡ | 8/51 | 15.7 | 7/64 | 10.9 | 15/115 | 13.0 |
| Azm | 2/30 | 6.7 | 1/39 | 2.6† | 3/69 | 4.3# | 6/21 | 28.6 | 6/25 | 24.0† | 12/46 | 26.1# | 8/51 | 15.7 | 7/64 | 10.9 | 15/115 | 13.0 |
| Tc | 24/27 | 88.9 | 32/33 | 97.0 | 56/60 | 93.3 | 19/19 | 100.0 | 21/21 | 100.0 | 40/40 | 100.0 | 43/46 | 93.5 | 53/54 | 98.1 | 96/100 | 96.0 |
Ab: antibiotic, Nal: nalidixic acid, Cip: ciprofloxacin; Ery: erythromycin; Azm: azithromycin; Tc: tetracycline; P < 0.05. Comparison between erythromycin resistance ∗ and azithromycin resistance † of C. jejuni and C. coli from control groups; P < 0.005. Comparison between erythromycin resistance ‡ and azithromycin resistance # of total recovered C. jejuni and C. coli.
Analysis by species only showed statistically significant differences in those regarding macrolide resistance. Thus C. coli showed higher levels of resistance than C. jejuni (12 isolates, 26.1% versus 3 isolates, 4.3%; P: 0.0012). The significance was also maintained between C. coli and C. jejuni from the control group (6 isolates, 24% versus 1 isolate, 2.6%; P = 0.0119), with borderline significance between C. jejuni and C. coli from the diarrhea group (P = 0.0521) (Table 4).
No association was observed between sex and macrolide or quinolone resistance. No association was found between susceptibility/resistance and a higher or lower presence of the VFs sought.
3.4. Analysis of the Mechanisms of Resistance
The analysis of the gyrA gene showed the presence of Thr86-Ile amino acid substitutions in the 102 NalRCipR and in 1 NalRCipS isolates, while in another C. jejuni, NalRCipS, the Thr86-Ala substitution was observed. Additionally, 3 C. jejuni isolates exhibiting susceptibility to both quinolones also possessed the Thr86-Ile substitution. Meanwhile, for the 34 nongrowing isolates the presence of Thr86-Ile was observed in 28 cases.
Resistance to macrolides was related to the presence of the base change A2075G in 13 out of 15 (86.7%) macrolide-resistant isolates. Interestingly in 2 out of these 13 isolates (both C. coli) double peaks were observed, highlighting the presence of mutations in only 1 or 2 of the 3 Campylobacter spp. 23S rRNA gene copies. Finally, 1 of the 2 macrolide-resistant isolates without a mutation in the 23S rRNA gene had an Ery halo of 19 mm and an azithromycin halo of 16 mm, while the remaining isolate had no halo to both of the macrolides tested. A Study of the Virulence of Campylobacter coli Essay.
4. Discussion
4.1. Microorganisms
Although a reduction in the burden of diarrhea has been observed in Peru, it has been estimated that in 2015 diarrhea led to 514 deaths in children less than 5 years of age (0.8 deaths/1,000 live births), accounting for 4.9% of deaths in this population (http://apps.who.int/gho/data/node.main.COCD?lang=en). In Peruvian rural zones and in periurban areas of Lima and other cities the lack of adequate sanitation conditions supports the high prevalence of diarrheic diseases. In these areas, Campylobacter spp. ranks after enteric viruses and enteropathogenic E. coli as etiologic cause of diarrhea [25].
The proportions of C. jejuni and C. coli in our study are quite different from previous studies performed in this area. Thus, analyzing 4652 Campylobacter spp. collected between January 2001 and December 2010 the presence of 3856 C. jejuni (82.9%) and 554 C. coli (11.9%) was detected together with other Campylobacter spp. [17]. Although the spread of a C. coli clone in the area may be suggested, there is no clear reason for these differences.
4.2. Virulence Factors
Previous studies have shown that almost all C. jejuni and C. coli possess the cadF gene [26, 27]. In this line, our results are as expected. Regarding the presence of 2 cadFnegative C. jejuni isolates, although possible insertion inactivation or deletion can not be ruled out, the presence of a polymorphism which might affect PCR-positivity has been previously described [27]. Meanwhile, both in the case of cdt and iam, the use of different primer sets increased the reliability of PCR results, confirming the presence of significant differences in the carriage of these VFs among C. coli and C. jejuni.
Although presence of polymorphisms in the primers annealing regions may not be ruled out, while all C. jejuni presenting the cdt operon possessed the 3 components, a series ofC. coli were positives for cdtB but not for cdtA and/or cdtC. This is a relevant finding because the lack of either cdtA or cdtC leads to an impaired production of CDT [28]. A Study of the Virulence of Campylobacter coli Essay.
Some studies have shown that the IAM region was more frequent in C. coli independently of whether it was from children (83.3%) or chicken (100%), being also frequent (54.7%) in C. jejuni from chicken but almost absent (1.3%) in those isolated from children [23]. In accordance with this, our results showed that C. coli carried the IAM region significantly more frequently than C. jejuni.
4.3. Antimicrobial Resistance
Symptomatic and asymptomatic Campylobacter spp. infections have been involved in reduced weight gain over three-month periods in children [29]. Although symptomatic infections were marginally associated with reduced linear growth over nine-month periods, the severity of the episodes was correlated with greater deficits in both weight gain and linear growth, demonstrating the need for early control of Campylobacterinfections [29].
A survey performed in Peru between 2001 and 2010 showed an increase in Cip resistance levels of both C. jejuni and C. coli. In Lima, the levels of Cip resistance were 73.1% and 48.1% for C. jejuni and C. coli, respectively, in the period 2001–2005, with those values rising to 91.1% and 87.4% in the period 2006–2010, respectively [17]. The most recent values are in accordance with the levels of Cip resistance detected in our isolates.
Similar to that described in other geographical areas [30], our results showed extremely high resistance levels to Tc of 100% among C. coli and 90% among C. jejuni. Though not used in the treatment of Campylobacter infections in young children, this scenario shows that Tc has lost all its utility in the treatment of Campylobacter spp. in Peru.
The macrolide resistance was higher in C. coli than in C. jejuni, similar to what has been observed in other studies [16, 17]. Overall, our macrolide resistance levels were higher than those previously reported in the area of Lima (C. jejuni 4.3% versus 1.9%; C. coli 26.1% versus 5.3% and 5.8%, Ery and Azm, resp.) [17]. In a previous study a significant increase in the C. coli Azm resistance over time in Lima was of note [17]. Our data confirm this trend and also show an increase in macrolide resistance among C. jejuni. All the macrolide-resistant isolates detected also showed resistance to quinolones, highlighting the need of new antimicrobial agents to treat Campylobacter infections.
4.4. Mechanisms of Quinolone and Macrolide Resistance
While most microorganisms possess 2 quinolone-targets (DNA-Gyrase and Topoisomerase IV), Campylobacter spp. only possess one of the DNA-Gyrases; thus a single target-mutation may lead to both high Nal and Cip resistance levels [8, 12, 31]. The GyrA amino acid change Thr86-Ile has been extensively described inCampylobacter spp. [8, 31]. The phenotype NalRCipS was observed in two C. jejuni, in one case related to the Thr86-Ala substitution. It has been observed that the Thr86-Ala substitution leads to increases in the Nal MIC, in some cases just low-bordering the resistance breakpoint, with a lesser effect on the Cip resistance levels [31].A Study of the Virulence of Campylobacter coli Essay. In addition, microorganisms either having the wild type presence of Ala [32] or presenting a mutation leading to the presence of Ala in the equivalent position of GyrA [33] present Nal resistance patterns, albeit usually lower than those produced by other amino acid substitutions, and decreased susceptibility to fluoroquinolones. This may be related to lower alterations in the hydrophobic patterns of the DNA-Gyrase interaction point [12, 32]. The remaining NalRCipS as well as the 3 NalSCipS isolates carrying the Thr86-Ile substitution might be explained by an enhanced quinolone uptake that may be due to a malfunction of efflux pumps or to enhanced outer membrane permeability.
The presence of mutations at position A2075 was found in all but 2 macrolide-resistant isolates. In two cases the data suggested the presence of heterozygote isolates, with only one or two mutated 23S rRNA. In these cases, as 33–66% of the ribosomes were resistant to the action of the macrolides, the isolates remained resistant to both Azm and Ery. The presence of 2 macrolide-resistant isolates without alterations in the 23S rRNA gene may be due to an overexpression of the CmeABC [21, 34]. This option is highly probable in the isolate having a borderline macrolide halo [34], while another explanation, such as the presence of amino acid substitutions in L4 or L22, might be considered in the other case [19]. In addition, the presence of TMMR, such as Erm(B) recently described inCampylobacter genus [22] cannot be ruled out.
In summary, the present data demonstrates high levels of Tc and quinolone resistance in both C. jejuni and C. coli and increasing macrolide resistance among C. coli. Moreover, the concomitant resistance to quinolones and macrolides is serious and may lead to the expansion of difficult-to-treat Campylobacter spp. isolates. The implementation of control measures which result in a more rational antimicrobial use in human infections, but especially in veterinary settings, is a priority. A Study of the Virulence of Campylobacter coli Essay.
Supplementary Material
Campylobacter spp. database.
Acknowledgments
This study was partially supported by the Agencia Española de Cooperación Internacional (AECID), Spain, and Programa de Cooperación Interuniversitaria e Investigación Científica con Iberoamérica (D/019499/08, D/024648/09). Joaquim Ruiz was supported by the I3 Program of the Ministerio de Economia y Competitividad, Spain (Grant no. CES11/012). “ISGlobal is a member of the CERCA Programme, Generalitat de Catalunya.” The authors thank Donna Pringle for editorial assistance.A Study of the Virulence of Campylobacter coli Essay.
