Role Of UHRF1 In Cancer Essay
Role Of UHRF1 In Cancer Essay
Question:
I. The role of UHRF1 in cancer
II. The role of UHRF1 in DNA methylation
III. The role of UHRF1 in Histone modifications
IV. Targeting of UHRF1 in cancer
Answer:
Introduction
UHRF1 or ubiquitin-like, containing PHD and RING finger domains, 1 belong to the RING-finger type subfamily of E3 ubiquitin ligase and are known to bind to hemi-methylated regions on the DNA during cell division (S-phase) and also recruits DNA methyltransferase gene for regulating gene expression and chromatin structure (Berkyurek et al., 2014). Role Of UHRF1 In Cancer Essay. Owing to the fact that UHRF1 coordinates histone modification and DNA methylation, is considered as a primary regulator of the epigenome. Moreover, UHRF1 mediates silencing of several tumor suppressor genes. This chapter will illustrate on the role of UHRF1 in cancer, DNA methylation, histone modification and targeting it in cancer cells.
I. Role Of UHRF1 In Cancer
UHRF1 plays the role of a major oncogene that is over-expressed in a range of haematological or solid tumors (Mudbhary et al., 2014). High levels of expression of URHF1 are found to be associated with reduced expression of a range of tumor suppressor genes, such as, BRCA1, p16 INK4A, KiSS1, and PPARG. UHRF1 leads to the formation of multiple coordinated dialogue that exist between histone post-translation modification and changes in DNA-methylation, thereby leading to silencing of tumor suppressor genes in an epigenetic way, which in turn facilitates the cancer cells to escape the process of apoptosis (Nishiyama et al., 2013). The tumor suppressor gene p16 INK4A participates in the G1/S cell cycle checkpoint. Role Of UHRF1 In Cancer Essay. Loss of expression of this gene often results in inhibition of apoptosis and enhances cellular proliferation. UHRF1 uses the SRA domain, and forms an interaction with DNMT1 and histone deacetylase 1 (HDAC1), at methylated promoter sites of the TSGs (Guan et al., 2013). UHRF1 overexpression have also been demonstrated in colorectal cancer and are associated with its progression (Zhu et al., 2015). In addition, overexpression of UHRF1 in primary non-small cell lung cancer (NSCLC) is related with an elevation of DNMT3A, DNMT1, and DNMT3B expression, which in turn is associated with hypermethylation of the p16 INK4A promoter.
UHRF1 is an epigenetic regulator and perform pivotal functions in cell tumorigenesis. We found UHRF1 is increased in breast cancer and patients with high UHRF1 levels have poorer prognoses than those with low UHRF1 levels. However, the underlying mechanisms remain largely unknown. Here, we found overexpression UHRF1 indeed promoted cell proliferation and migration, whereas its downregulation had the opposite functions. In vivo, UHRF1 also accelerated tumor growth. Mechanistically, microarrays were performed in MDA-MB-231 sh-UHRF1 and NC cells and KLF17, with rich CpG islands on its promoter region, finally caused our attention. Then, the expression of UHRF1 and KLF17 was testified negatively correlated in breast cancer cell lines and tissues. Additionally, the inhibition of cell proliferation and migration by UHRF1 depletion can be rescued by KLF17 silencing, suggesting KLF17 is downstream gene of UHRF1. The potential mechanism is that overexpression UHRF1 increased methylation of CpG nucleotides on KLF17 promoter, while UHRF1 silence decreased methylation. Collectively, our results demonstrated that increased UHRF1 can promote breast cancer cell proliferation and migration via silencing of KLF17 expression through CpG island methylation on its promoter. Role Of UHRF1 In Cancer Essay.
Ubiquitin-like protein containing PHD and ring finger domain 1 (UHRF1), also known as ICBP90 in humans and Np95 in mice [1], was first isolated by Fujimori A in 1998 and was believed to be associated with cell proliferation due to its strong expression in the testis, spleen, thymus, and lung tissues [2]. As reported, UHRF1 contains multiple domains, including ubiquitin-like domain (UBL), tandem tudor domain (TTD), plant homeodomain (PHD), SET- and RING-associated domain (SRA, where RING domain denotes really interesting new gene domain), all of which are essential for biological functions in cells. The SRA domain was proven to identify hemi-methylated DNA and recruit DNA methyltransferase 1 (DNMT1) to hemi-methylated replication forks to complete DNA replication [3,4], and the RING domain has been shown to be associated with E3 ubiquitin ligase activity [5,6]. Studies have shown that the unmodified N-terminus of histone H3 was recognized by the PHD domain for participation in epigenetic modifications and that TTD domain specifically binds with histone H3 lysine 9 trimethylation (H3K9) for histone deacetylation [7]. Role Of UHRF1 In Cancer Essay.
In the last 15 years of research on UHRF1, additional detailed functions and mechanisms of UHRF1 were discovered. Previous studies demonstrated that UHRF1 was localized in S-phase nuclei and expressed strongly only in proliferative normal tissues and cells but maintained a constantly high level throughout all stages in cancer cells [8,9], suggesting that UHRF1 is a cell cycle regulator and is essential for cell S-phase entry functions as a checkpoint for G1/S transition. The imbalance of cell cycle processes might induce cell apoptosis. Indeed, other studies showed that downregulation of UHRF1 could induce cell apoptosis [10,11] and might cause a positive feedback loop between UHRF1 and apoptosis because p53/p21Cip1/WAF1-dependent DNA-damage checkpoint signals can lead to reduced UHRF1 expression, which might result in cell apoptosis through DNA-damage checkpoint signals [12]. Furthermore, UHRF1 was revealed to bind a CCAAT box of the topoisomerase II alpha gene promoter and increase its expression in non-proliferating conditions while inhibiting RB expression by combining with the same sites on the RB promoter regions [13,14].
As research has progressed, attention has moved to epigenetics. It was shown that UHRF1 contains a methyl DNA binding domain (SRA) for preferential binding to hemimethylated CG sites and collaborates with DNA methyltransferase protein (DNMT1) throughout S-phase to downregulate genes such as RB, ERa, and VEGF [15-17]. Additionally, recognition of hemi-methylated DNA by the SRA protein UHRF1 was reported as a base-flipping mechanism [18]. Methyltransferases 3A and 3B are also selectively enrolled in nucleosomes and the epigenetic silencing of the viral CMV promoter in embryonic stem cells [19]. UHRF1 also methylates histone H3 and acetylates or deacetylates histones. As shown, UHRF1 co-localizes with histone lysine methytransferase G9a to inhibit p21 promoter activity [20] and also interacts with tat-interactive protein 60 KD (tip60) to decrease the acetylation of its specific binding site H2AK5 [21]. Thus, UHRF1 indeed participates in chromosome stability and chromatin remodeling processes due to the two hallmark functions of UHRF1 methylation and histone H3 deacetylation.
Thus far, several target genes such as RB, ERa, VEGF, p21, and p16 are known to act as tumor suppressors can be downregulated by UHRF1 in primary human cancers. And certain achievements have been reported due to those discoveries, however, the mechanism of UHRF1 in tumorigenesis still remains unclear and requires additional research, especially in breast cancer.Role Of UHRF1 In Cancer Essay. In our previous study, we reported that UHRF1 could inhibit MDR1 transcription by directly binding to its promoter and inducing the deacetylation of histones H3 and H4 on the MDR1 promoter [22]. We also found that UHRF1 was responsible for regulating BRCA1 transcription by inducing DNA methylation, histone modifications, and recruitment of transcriptional complexes on the BRCA1 promoter [23].
In our current study, we focus on validating potential downstream genes of UHRF1 by microarray in MDA-MB-231 model cells and finally find KLF17 is downstream gene of UHRF1, by which UHRF1 can promote breast cancer migration and proliferation. This study offers insight into breast cancer progression and suggests that making changes to this mechanism may represent new therapeutic approach to blocking breast cancer development.
Materials and methods
Cell culture
Normal breast cells MCF10A (ATCC) were cultured as previously reported [24]. The human breast cancer cell lines MCF-7, BT549, MDA-MB-468, MDA-MB-231, SK-BR-3 and T47D were obtained from the American Type Culture Collection (ATCC) (Manassas, VA, USA), and human embryonic kidney (HEK) 293T cells were purchased from the cell bank of the Chinese Academy of Sciences (CAS, Shanghai, China). Role Of UHRF1 In Cancer Essay.All cells were cultured in completed medium mixed with 10% fetal bovine serum (Thermo, Beijing, China), according to ATCC instructions. 5-Aza-CdR was applied to cells for methylation inhibition, and the cells were exposed continuously at 5 μmol/L for two days (Sigma, St. Louis, MO, USA).
Patients and samples
Human breast cancer tissues were obtained with written informed consent from Shanghai Cancer Center at Fudan University. Ethics approval was obtained from the Committee of Ethical Research at Shanghai Cancer Center. Approximately 120 specimens (Table 1) of pathologically and normally diagnosed biopsy specimens (3 cm away from breast cancer tissues) were collected between 2009 and 2012 from patients with breast cancer, including 20 with normal tissues. We also collected clinical information from each patient, namely, age, tumor differentiation, and lymph node metastasis. All lesions were diagnosed according to the diagnostic criteria defined by the Evidence-Based Cancer Guidelines (NCCN, 2011).
Table 1
Clinical-pathological variables and the expression of UHRF1 in the studied cases
| Variables | Number of patients (%) | UHRF1 expression | P value | |
|---|---|---|---|---|
|
|
||||
| Low N (%)a | High N (%)a | |||
| Total | 118 | 57 (45.6) | 61 (54.4) | |
| Age | 0.469 | |||
| ≤50 | 48 (40.7) | 25 (21.2) | 23 (19.5) | |
| >50 | 70 (59.3) | 32 (27.1) | 38 (32.2) | |
| Menopausal status | 0.752 | |||
| Premenopausal | 50 (42.4) | 25 (21.2) | 25 (21.2) | |
| Postmenopausal | 68 (57.6) | 32 (27.1) | 36 (30.5) | |
| Tumor size | 0.105 | |||
| ≤2 cm | 44 (37.3) | 17 (14.4) | 27 (22.9) | |
| >2 cm | 74 (62.7) | 40 (33.9) | 34 (28.8) | |
| Lymph node status | 0.029* | |||
| Negative | 72 (61.0) | 29 (24.6) | 43 (36.4) | |
| Positive | 46 (39.0) | 28 (23.7) | 18 (15.3) | |
| ER status | 0.100 | |||
| Negative | 57 (48.3) | 32 (27.1) | 25 (21.2) | |
| Positive | 61 (51.7) | 25 (21.2) | 36 (30.5) | |
| PR status | 0.854 | |||
| Negative | 59 (50.0) | 29 (24.6) | 30 (25.4) | |
| Positive | 59 (50.0) | 28 (23.7) | 31 (26.3) | |
| HER2 status | 0.233 | |||
| Negative | 81 (71.7) | 43 (38.1) | 38 (33.6) | |
| Positive | 32 (28.3) | 13 (11.5) | 19 (16.8) | |
| Unkown | 5 (4.2) | |||
| Ki67 | 0.442 | |||
| ≤14 | 35 (29.7) | 15 (12.7) | 20 (16.9) | |
| >14 | 83 (70.3) | 42 (35.6) | 41 (34.7) | |
| Grade | 0.184 | |||
| 1 | 6 (5.1) | 5 (4.2) | 1 (0.8) | |
| 2 | 88 (74.6) | 42 (35.6) | 46 (39.0) | |
| 3 | 24 (20.3) | 10 (8.5) | 14 (11.9) | |
| KLF17 level | 0.022* | |||
| Low | 68 (57.5) | 39 (33.1) | 29 (24.5) | |
| High | 50 (42.4) | 18 (15.3) | 32 (27.1) | |
RNA preparation and reverse transcription of cDNA
Total RNA was extracted from breast cancer cells treated with sh-RNA or overexpression vectors using TRIzol (Life Technologies, Rockville, MD, USA). First-strand cDNA was synthesized from 1 μg total RNA with Primer Mix and RT Enzyme Mix (Toyobo, Japan), according to the manufacturer’s instructions.
Quantitative real-time PCR
Real-time PCR was performed in a 20 μL reaction, which included 3 μL cDNA templates, 5 µM each of forward and reverse primer, and 10 μL SYBR buffer (Takara, Tokyo, Japan). The working conditions were 95°C for 5 min, followed by 95°C for 40 cycles and finally 60°C for 30 s. The primer pairs were used as follows: UHRF1 forward primer: ACACTTGGCTAGTCGTTAATGC, reverse primer: TATGGCCGTCCTCCATCTGT; KLF17 forward primer: AGGGGATGGTGCGATAGATT, reverse primer: GCCTCACCCTCACCTAACAAA; GAPDH forward primer: CCACTAGGCGCTCACTGTT, reverse primer: TGGAATTTGCCATGGGTGGA.
Methylation-specific PCR (MSP)
Genomic DNA was extracted from fresh breast cancer samples and cells as mentioned above using a Genomic DNA Purification Kit (Qiagen, Hilden, Germany). The extracted DNA (1 µg) underwent bisulfite conversion using a sodium bisulfite procedure with the EZ DNA Methylation-Gold Kit (Qiagen, Valencia, Canada), according to the manufacturer’s protocol.Role Of UHRF1 In Cancer Essay. The MSP methylation primers were designed by Methyprimer as follows: methylation primers: TTTAGGTTGGAGTGTAATGGC, ATTAACCAAACGTAATAACGCGTA, unmethylation primers: GTTGTTTAGGTTGGAGTGTAATGGT, AATTAACCAAACATAATAACACATA. The PCR products were separated on 2% agarose gels and visualized with ethidium bromide staining.
Bisulfite sequencing
Each of the DNA samples was amplified by PCR using bisulfite primers: TTTGTTGTTTAGGTTGGAGTGTAAT, AATCACTTAAAATCAAAAATTTAAAACC.
The PCR products were cloned into pMD-18T (TaKaRa, Japan) according to the manufacturer’s instructions, and ten positive clones were sequenced. The data were analyzed using the QUMA analyzer software [25].
Construction of stable UHRF1 cell lines
Lentiviral and retroviral production 293T cells were used in lentiviral production. Lentiviral vectors expressing shRNAs against human KLF17 from the shRNA library were purchased from Genechem (Shanghai, China). Cells were transfected with lentiviral vectors following standard procedures, and viral supernatant was used to infect MDA-MB-231, ZR-75-30 and MCF-7 cells. The cells were treated with puromycin (2 μg/ml) for 48 h.
Cell migration assay
A cell suspension of 1×105 cells in 0.2 ml DMEM medium without FBS was seeded into each well of the upper trans-well chamber, and 500 µL 10% FBS was added to the lower chamber (Corning Costar Corp, America). After incubation for 9 h, the chambers were fixed and stained with 2% crystal violet for 25 min. The number of cells penetrating across the membrane was counted under a microscope in 7 random visual fields. Role Of UHRF1 In Cancer Essay.
Cell proliferation assay
In brief, control (NC) and transfected cells were seeded at a density of 1×104 cells/well in a 96-well plate. The proliferation assay was performed every 24 h using CCK8 reagent (Dojindo, Japan). The supernatant was measured using a microplate reader at a wavelength of 450 nm. Each experiment was performed in three parallel wells and was repeated three times.
Mouse experiments
Four- to six-week-old athymic nude mice were injected orthotopically with 5.0×106 cells into the mammary fat pads. After 7 weeks of implantation, the tumors were harvested, weighed and fixed in formalin for further investigation.Role Of UHRF1 In Cancer Essay.
Statistical analysis
The means ± the standard deviation (S.D.) were calculated and presented for each data point. Statistical analyses were performed using a paired Student’s t test. For all experiments, P values <0.05 were considered statistically significant. Role Of UHRF1 In Cancer Essay.
Results
UHRF1 expression is significantly increased in breast cancer and associated with poor prognosis
To verify UHRF1 expression in breast cancer, we first tested its expression in 20 paired breast cancer and juxtacancerous tissues using real time-PCR assay. The results showed that expression of UHRF1 in breast cancer (BC) tissues was significantly elevated compared with normal or adjacent tissues (Figure 1A). Similar results were also obtained from the Oncomine database according to Curtis breast statistics (Figure 1B). We also observed that the level of UHRF1 was upregulated in several breast cancer cell lines, including MCF-7 and SK-BR-3 etc, compared with normal breast epithelial cells MCF-10A (Figure 1C). Given that the clinical value lay in whether increased UHRF1 expression could impact patient prognosis, we interrogated the Kaplan-Meier plotter database and found that patients with higher UHRF1 levels have shorter disease-free survival times than those with lower UHRF1 expression (Figure 1D).
UHRF1 expression is increased in breast cancer and associated with poor prognosis. A. Quantitative analysis of UHRF1 expression level in breast cancer tissues and adjacent normal tissues (n = 20, breast cancer vs. adjacent). Role Of UHRF1 In Cancer Essay. B. UHRF1 expression in breast cancer according to Oncomine analysis. C. UHRF1 expression in normal human breast epithelial cells and breast cancer cells. D. Prognosis of patients in two groups based on UHRF1 expression was analyzed by Kaplan-Meier.
UHRF1 expression affects breast cancer cells growth and migration
Stable overexpression and knockdown cell lines were constructed, and the transfected efficiency was validated by western blotting, as presented in Figure 2A and and2B.2B.Role Of UHRF1 In Cancer Essay. The cell proliferation was tested by CCK8 assay, and the results showed that overexpression of UHRF1 can significantly promote cell growth, whereas knockdown of UHRF1 expression impedes cell proliferation (Figure 2C). In addition, cells with upregulated UHRF1 have stronger migration ability than vector (PCDH) cells, and the depletion of UHRF1 presents an opposite result (Figure 2D). In vivo, MDA-MB-231 cells transfected with UHRF1 or PCDH were subcutaneously inoculated into nude mice, and the results showed that UHRF1 could accelerate tumor growth (Figure 2E).
UHRF1 is associated with breast cancer progression. A and B. Stable cell lines were constructed and validated by western blot (overexpression: MCF-7, MDA-MB-231; knockdown: ZR-75-30, MDA-MB-231). C. Proliferation of stable cell lines. D. Migration of stable cell lines. E. Role of UHRF1 in tumor growth in vivo. Role Of UHRF1 In Cancer Essay.
KLF17 is a candidate downstream gene of UHRF1
To investigate the potential mechanism of UHRF1 associated with breast cancer, gene microarray was employed to MDA-MB-231 cell models. Based on database analysis from the microarray, approximately 3000 genes changed when the absolute cut-off value was set to 2-fold (Figure 3A). However, when combined with a PubMed search, 38 candidate genes were obtained by analysis from the microarray databases and oncogenes or TSGs search on PubMed. The candidate genes were firstly testified in MDA-MB-231 cells transfected with PCDH or UHRF1 (Figure 3B). Then 23 genes were chose to further confirm in MDA-MB-231 NC and sh-UHRF1 cells. The results showed that only 4 genes were downregulated in UHRF1 overexpression cells and upregulated in UHRF1 downregulation cells. Among them, Krüppel-like factor 17 (KLF17) with rich CpG islands on its promoter was most remarkably one and cause our attention (Figure 3C). Role Of UHRF1 In Cancer Essay.
